Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST127435
Clone ID OST127435
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST127435
Sequence
GACTGAGCATGGGAGTCATTGTCCTGGGCTATACTGGAAGCATGCGCCCAAGACCTGCAAGAACTTCGCGGAGCTGGCTC
GGCGGGGCTACTACAATGGCACCAAGTTCCACAGGATCATCAAGGACTTCATGATCCAAGGCGGCGACCCGACAGGCACA
GGTCGAGGTGGCGCATCTATTTATGGCAAACAGTTTGAAGATGAGCTTCATCCAGACCTGAAGTTCACTGGGGCTGGGAT
TCTCGCGATGGCCAACGCAGGACCTGATACCAATGGCAGCCAGTTCTTTGTGACCCTGGCCCCCACGCAATGGCTGGACG
GCAAGCATACTATTTTTGGCCGAGTGTGCCAGGGTATAGGGATGGTGAATCGAGTGGGCATGGTGGAAACAAACTCCCAG
GACCGTCCTGTGGACGACGTGAAGATTCTTAAGGCGTACCCCTCTGGATAGGNGGGATGCTGNCCCCGGCACACCCAGGC
CCCCGGGAGCTGGTTTCCA
Sequence Type mRNA
Unitrap ID UNI12956

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29388403..29398838 258
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024007 (Ppil1) NM_026845 peptidylprolyl isomerase (cyclophilin)-like 1 Gene [Source:MGI (curated);Acc:Ppil1-001]

 
Come back to gene ENSMUSG00000024007


For any suggestions or comments, please send an email to unitrap@crg.es