Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST126979
Clone ID OST126979
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST126979
Sequence
GACTGAGGTGTCCCAAGCTAGAGGTAAGCATGGCAGTAACAGGAACCCACTGCTGAGCAGCTTGCGCAGATAGCTGCAGA
GAATGAGGAAGATGAGCACTCTGTGAACTACAAGCCTCCAGCCCAGAAGAGCATCCAGGAGATCCAGGAACTGGACAAGG
ACGATGAAAGCCTCCGAAAGTACAAGGAGGCCCTGCTGGGCNCGAGTAGCTGTCTCTGCAGACCCCAACGTCCCCAATGT
CATGTGTGACTCGACTGACCTTGGTATGCAGCACTGCCCTAGGCCTTNTGGAANTGNTCNTGACANNGNAGCCNCGAGAN
GCTTNAGAGAAANATNCAGTNTGTTGTTGAAGGAAGGGCGCGGNGNACCTACTANTAAAGNTTNTTTCCNGGNTGAACAA
GAAAGANTCGTGTCCGNCATGAAGTACATCCAACACACNTATAGGAAAAGGGGTCAAAAT
Sequence Type mRNA
Unitrap ID UNI25978

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 120440830..120441709 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025132 (Arhgdia) NM_133796 Rho GDP dissociation inhibitor (GDI) alpha Gene [Source:MGI (curated);Acc:Arhgdia-001]

 
Come back to gene ENSMUSG00000025132


For any suggestions or comments, please send an email to unitrap@crg.es