Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST126957
Clone ID OST126957
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST126957
Sequence
ACTGAGATGGATGCATTACAGGACTATTCCCATAATTCATTTGACCTGCAGTGTCTGTTAAATTCGTTTCCCGGAGATTT
GGAGTTTAAGCAGATCTTCAGTGACATTGGAGAACAGATGGAGCAAAATGCTGCAAGTATAGAACATTGCATTGAAGAAA
TACAGTCTGAAGTAAACAAGCTCTGTCCAGATGCACAGCTACAAACAACAAGTGACTGCTTCAAATGGCTAACTAGGGNG
GGTTATAATTTATCTAAGTCACCATCCATTTCCCATGGAGATTTAATAAACTTCCTCAAAACAATGGTAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI18689

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 77314115..77323037 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071252 (2210408I21Rik) NP_001074822 RIKEN cDNA 2210408I21 gene Gene [Source:MGI Symbol;Acc:MGI:1919621]

 
Come back to gene ENSMUSG00000071252


For any suggestions or comments, please send an email to unitrap@crg.es