Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRR754
Clone ID RRR754
Vector pGT0Lxf
Project baygenomics

Sequence tag RRR754
Sequence
TGCAGCAACAAGAGGAGCTTGTAATTTTAAACGGAGGCTGAAGACACTGTAGAATTAGCAGACATAAGAGAGCGTGGAGA
AGGCAGAGGATGGAGTTGCAGACTCTACAGGAGGCTCTTAAAGTGGAAATTCAGGTTCACCAGAAACTGGTTGCCCAAAT
GAAGCAGGATCCACAGAATGCTGACTTAAAGAAACAGCTTCATGAACTCCAAGCCAAAATCACAGCTTTGAGTGAGAAA
Sequence Type mRNA
Unitrap ID UNI7400

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 92061630..92070878 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058318 (Phf21a) NM_138755 PHD finger protein 21A Gene [Source:MGI (curated);Acc:Phf21a-002]

 
Come back to gene ENSMUSG00000058318


For any suggestions or comments, please send an email to unitrap@crg.es