Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST126815
Clone ID OST126815
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST126815
Sequence
CTGGTGAGCAATACTAAGATAGATGGACCGTTACTACAAATTCTATTTATGAACAATGCTATCTCAAAGCANTACCACCA
AGAAATAGAGGAGTTTGTATCAAACTTAGTAAAACGATTTGAGGAACAGCAAAAAAATGACGTGGAAAAGACTTCCTTCA
GCCTTTTACCCCAGCCGTCCAGTGTTATGTTGGAAGAGGACCATAAAGTGGAAGAATCATGTGCCGNNGAAAACAACAAG
GAAGCTTTTAGTGTTGTAGGAAGNGTCCTGTATTTTACTAATTTTTGCCTTGATAAATNGGGGCAACCGCTACTAAATGA
AAACCCTCAGCTTACGGANGGATGGGAAATACCCAAGTATCCTACATAGTGAATGAA
Sequence Type mRNA
Unitrap ID UNI26288

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 124159370..124167060 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029427 (Zcchc8) NP_081770 zinc finger, CCHC domain containing 8 Gene [Source:MGI Symbol;Acc:MGI:1917900]

 
Come back to gene ENSMUSG00000029427


For any suggestions or comments, please send an email to unitrap@crg.es