Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRR770
Clone ID RRR770
Vector pGT0Lxf
Project baygenomics

Sequence tag RRR770
Sequence
AGTCCTACCTGGAGCTCTATCGAAAGCAAAAGAAGCACCTGAACTCGCAGCAGCTGACCGCCTTCCAGCTGCTGTTTGCT
TGGAGGGATAAGACAGCTCGCAGGGAGGATGAGAGCTACGGATATGTTCTACCAAATCACATGATGCTAAAGATAGCTGA
GGAACTGCCTAAGGAGCCTCAAGGCATCATAGCTTGCTGTAACCCAGTACCACCTCTTGTCCGGCAGCAGATCAATGAGA
TGCATCTCCTAATCCAGCAGGCTCGAGAGATGCCCCTGCTCA
Sequence Type mRNA
Unitrap ID UNI7655

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 147942504..147944605 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017264 (Exosc10) NM_016699 exosome component 10 Gene [Source:MGI (curated);Acc:Exosc10-005]

 
Come back to gene ENSMUSG00000017264


For any suggestions or comments, please send an email to unitrap@crg.es