Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST126580
Clone ID OST126580
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST126580
Sequence
CAATCCCCGCTCTGCCCNATCTGCCAAGTCCTGACTGAGGCCCAGNCGAGNTGCNTGANCATANNGAGNANGAACTGGAA
CATGGCTGGCCCAGNTGCCTGCCAGCAAAAATTCCCTTCTGAAGGATGCCATGGCTCCGGT
Sequence Type mRNA
Unitrap ID UNI20009

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116972161..116980251 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]

 
Come back to gene ENSMUSG00000028677


For any suggestions or comments, please send an email to unitrap@crg.es