Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRS046
Clone ID RRS046
Vector pGT0Lxf
Project baygenomics

Sequence tag RRS046
Sequence
ACAAGAACAAGTTTTAGAAACTAAGATACCAAATGGAGTGAGTTCAAATCCAGATTTACCAGCACATCCTGACGCACACT
TGGAAATTCACAGAAAAAAGGCGGTTACACCTTTGGACATGAATCGCTTTCAGAGTAGAGCCTTCCGTGCTGTCATTTCA
CAGCAGAGGGGGCAGGACCCCACCTTTCCACCAGTACGGCAGCCACTTACTAAGGAGCCCTCTTTACACCTGGACACACC
ATCAAAGTTTCTGTCCAAGGACAAGCTTTTCAAGCCATCCTTTGATGTGAC
Sequence Type mRNA
Unitrap ID UNI7668

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 103230735..103231022 286
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032555 (Topbp1) NM_176979 topoisomerase (DNA) II binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1920018]

 
Come back to gene ENSMUSG00000032555


For any suggestions or comments, please send an email to unitrap@crg.es