Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST125712
Clone ID OST125712
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST125712
Sequence
TGCCTCCAGCCTTCCACTTGCCCTTCCCAGGACCTACCCTGGCCTTCCTGGTACTCAGCACACCTGCTATGTTTGACAGA
GCCCTCAAACCCTTCTTAAAGAGCTGCCACTTCCAAACACTGAGAGACCCGGTGGATCAATGTGTGTCCTACCACCTGAG
GAGTGTTACAGAGAAGTTTCCAGAAGTGCATATGGAAGTCATTGCTGACTATGAGGTACACCCCAATCGGCGACCTAAGA
TTCTCGCCCAGACAGCAGCCCATGTGGCAGGTGCTGCTTATTACTACCAACGACAAGATGTGGATGCAGACCCATGGGGG
ACCCAGGTTATAGAGGGA
Sequence Type mRNA
Unitrap ID UNI3426

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116377100..116378658 173
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028690 (Mmachc) NP_080238 methylmalonic aciduria cblC type, with homocystinuria Gene [Source:MGI (curated);Acc:Mmachc-001]

 
Come back to gene ENSMUSG00000028690


For any suggestions or comments, please send an email to unitrap@crg.es