Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST125599
Clone ID OST125599
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST125599
Sequence
GAACTGAGGCAGACTGAGCTCTTACTTCTGGGGACNAAGGANAATCCANGATTANAGACAATCCAGGCCACCCTGTCTAG
GCNNGGGATCGACCATGAGTATCTTTCGTCAGNGGATTNAAAGCAACTGCTTTNCAAACATTCGGTTCACCAGGGGAGAA
GTGGGGCTCTTGGACAAGACTGGAGGTGTCCTCTATGCAGACAAGGCCCTCAGAGCCCTCCAGCATATAATTTGTCAGCT
AGGAGGCACTGTGTGTGATGGAGAGAAGGTAGTGGAGATAAGACCTGGTCTACCCGTCACAGTGAAAACCACCTTGAAGA
GCTACCAAGCCAACAGCTTGGTCATCACTGCTGGTCCCTGGACCAACCGGCTTCTGCATCCTCTGGGGATTGAGTTGCCT
CTCCAGACCCTTAGGATCAATGTGTGTTACTGGCGAGAGAAGGTCCCTGGGAGCTATGGTGTATCACAAGCTTTTCCATG
CATCCTGGGTCTGGATCTGGCCCCCCACCACATCTATGGACTGCCAGCATCCGAGTACCCGG
Sequence Type mRNA
Unitrap ID UNI2106

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77696130..77697496 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017453 (Pipox) NM_008952 pipecolic acid oxidase Gene [Source:MGI (curated);Acc:Pipox-001]

 
Come back to gene ENSMUSG00000017453


For any suggestions or comments, please send an email to unitrap@crg.es