Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST125192
Clone ID OST125192
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST125192
Sequence
CCTTGCACATGAAGCNACACATGTAGCCTGGGTCGACTCGGCTAGCCCATGCGCTGACTGTGGCAGGTTCCACGCGCGGG
GCACNGGTCCCCTTGCAAACAGACTGCTATTTATTGGACCTTAGGACAGAGCCGGACAAGTGTGGCCACAGGAAAATGAC
TCTGCCACCAGTTCTGGCCCCCACAGTGACTGAAGGCCCCAGGAAAGAAGACAGGAGTCTGTGAAGAATGTTTTCAAAAT
GGTGCAATAATTGACTTATTTCCCTCGGGTCCCCACTAGAGGATCGAGGCTAGATGCCTTGTGAGAAATGCCTTTGAGTT
TACTGTCCCCAACGNTTTTATAATATTGNATATAAGACTATGACCGATTGNATTTCTGTGAATTCTTAAAAA
Sequence Type mRNA
Unitrap ID UNI14418

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 74844793..74845167 361
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055148 (Klf2) NM_008452 Kruppel-like factor 2 (lung) Gene [Source:MGI (curated);Acc:Klf2-001]

 
Come back to gene ENSMUSG00000055148


For any suggestions or comments, please send an email to unitrap@crg.es