Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST125171
Clone ID OST125171
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST125171
Sequence
AACTGAGGTGAAGAGACTGTTTTCTGAGGCTGCGTTGGAGGCTGTGACCGAGCAGAGAGCCCATGTGAACTGATGGGGAG
GCTTTCTGAATAACATGGCCTTTTGCCATTAGCCTTGCCATGACCACATTTTTCACCAGCAGTCCCTCCCTGGATTCAAG
ATGCAAAGCAGGAGGAGGAAGTGGGCTAGGAAACTAGTTCCCAGGCCTCGGGGCCGGGAGGCAGAGAGTCAAGTGAAGTG
CCAATGTGAAATCTCGGGGACACCATTTTCAAATGGGGAGAAGCTAAGGCCTCACAGCCTTCCCCATCCGGAGCAGAGAC
CATATAGCTGTCCTCAGCTGCACTGCGGCAAGGCTTTTGCCTCCAAGTACAAGCTGTATAGGTAGGTGACACTCCCATTC
CTCTTTCAGTTTCCAGGTTCCTGGAGCTCACAACCAGAGACTCCATTGAGAGTGAACGGTAAAGNTGTCCTGTGAGTATA
CTATGAACTCTAACCATTTGAAGTCACTCACTAAATAGTAATAATGGTTTAGCTGGATATGGA
Sequence Type mRNA
Unitrap ID UNI26322

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 153061375..153061910 521
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051413 (Plagl2) NM_018807 pleiomorphic adenoma gene-like 2 Gene [Source:MGI (curated);Acc:Plagl2-001]

 
Come back to gene ENSMUSG00000051413


For any suggestions or comments, please send an email to unitrap@crg.es