Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST124979
Clone ID OST124979
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST124979
Sequence
GAACTGAGGTACCTTTCAGATGAAGGCGTTGAAGCCTGCACAAGCTCTCCTGGGAAAGGCAGCATAAATGACATCATCCT
GATTGCTCTCAATGNAGANNAAGGCACCTATGATCACACCATTGNNTNCCGCAAAGGAGGTGATGGACAGNCACAAAGGN
NTACTNGGCCANCGCAGNAANTNTACCAANCTNCTCGAGCTNGGAACTAANGNGAANGGGCTTTTGAGAAGGAAGATCCA
CTGACTGANCCATNCTGGAAGCCCACTGATNGATTTTCCACTTNTTCAGAGAGAGACTCAATATGCTGGATATGATTTTT
GGAGA
Sequence Type mRNA
Unitrap ID UNI20281

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 87856839..87945170 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022019 (Tdrd3) NM_172605 tudor domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2444023]

 
Come back to gene ENSMUSG00000022019


For any suggestions or comments, please send an email to unitrap@crg.es