Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRS150
Clone ID RRS150
Vector pGT0Lxf
Project baygenomics

Sequence tag RRS150
Sequence
TGATCGCCCGGTGCAGCGCAGCTCAGCGCGGCGCAGCGCGACTACCTTTCTGCAGCCGAGCGGTCGGGGCTGGTGAGTCC
TGGGCCTGGAGACCCAAGGAGGGCCCGCTCCGCGCCTGATCGCCCGGTGCAGCGCAGCTCAGCGCGGCGCAGCGCGACTA
CCTTTCTGCAGCCGAGCGGTCGGGGCTGGTCAGGACAAAGAGGTGTGAGCAGGCTTACTGAGCTGGCTGATCCATCATGG
CG
Sequence Type mRNA
Unitrap ID UNI7692

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57299788..57315811 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040722 (Scamp5) NM_020270 secretory carrier membrane protein 5 Gene [Source:MGI Symbol;Acc:MGI:1928948]

 
Come back to gene ENSMUSG00000040722


For any suggestions or comments, please send an email to unitrap@crg.es