Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRS222
Clone ID RRS222
Vector pGT0Lxf
Project baygenomics

Sequence tag RRS222
Sequence
CACACACCCGTGCTAGTCACTGCAGTGTGTTTACATGAGTAATGGAGCCGGGGGAGGGGACATGCGAGCAGCGCTGAGCC
TCCTCGCAGTTAGGTAAGCCGATATCCACACCAAGACCAGACTCCCAGGGATGCGGCTGGGGAACCGTCCCCTCCCGGAG
CTTTCCTGAGCACAGGCATCGATCAGGCAGATGTTTGGCGACTGGAATGGCGCCAAATCTTAAAGGCAGACCGCGCAAAA
AGAAAACATGTCCCCAGAGAAGAGATTCCTTCAGTGGCTCAAAGGACCCCAACAATAACTGTGACGGTAAAGTTATCAGC
A
Sequence Type mRNA
Unitrap ID UNI3599

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 67597744..67599442 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019947 (Arid5b) NM_023598 AT rich interactive domain 5B (MRF1-like) Gene [Source:MGI Symbol;Acc:MGI:2175912]

 
Come back to gene ENSMUSG00000019947


For any suggestions or comments, please send an email to unitrap@crg.es