Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST124539
Clone ID OST124539
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST124539
Sequence
GAACTGAGGGTCGAGCTGTGCAGTTTCAGCGGGTACAAGATCTACCCGGGACACGGGCGGCGCTACGCCAGGACCGACGG
GAAGGTTTTCCAGTTTCTTAATGCAAAATGTGAGTCAGCATTCCTTTCCAAAAGGAATCCTCGGCAGATAAACTGGACTG
TCCTCTACAGAAGGAAACACAAGAAAGGGCAGTCGGAAGAAATTCAAAAGAAAAGAACCCGCCGTGCAGTCAAATTCCAA
CGAGCCATCACTGGTGCATCTCTTGCTGATATAATGGCCAAGAGGAATCAGAAACCAGAGGTTAGGAAAGCCCAGCGAGA
GCAGGCTATCAGGGCTGCCAAGGAAGCAAAAAAGGCTAAGCAGGCATCAAAGAAGACAGCAATGGCTGCTGCCAAGGCCC
CCACAAAGGCAGCACCTAAACAAAAGATTGTGAAGCCTGTGAAGGTCTCTGCCCCCAGAGTTTGGTGGGAAACGCTAGTG
TGGTAGAGCAGAGTTTGGAAATAAAGCTCTATCTTTAACTCTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI13286

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 55966658..55971548 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022601 (Rpl24) NM_024218 ribosomal protein L24 Gene [Source:MGI (curated);Acc:Rpl24-005]

 
Come back to gene ENSMUSG00000022601


For any suggestions or comments, please send an email to unitrap@crg.es