Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST124508
Clone ID OST124508
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST124508
Sequence
ACTGAGTGTATCCTGAGGGTACCGGCGGGTGTTTGAGGAGTACATGCGGGTTATCAGCCAGCGGTATCCAGACATCCGCA
TTGAAGGCGAGAATTATCTCCCTCAACCAATTTATAGACACATAGCATCTTTCCTGTCAGTCTTCAAACTAGTATTAATA
GGCTTAATAATTGTTGGCAAAGATCCTTTTGCTTTTTTCGGCATGCAAGCTCCTAGCATCTGGCAGTGGGGCCAAGAAAA
TAAGGTTTATGCATGTATGATGGTTTTCTTCCTGAGCAACATGATTGAGAACCAGTGTATGTCAACAGGTGCATTTGAGA
TAACTTTAAATGATGTGCCAGTGTGGTCTAAGCTGGAATCTGGACATCTTCCATCCATGCAACAACTTGTTCAAATTCTT
GACAATGAAATGAAACTCAATGTGCATATGGATTCAATCCCACATCATCGATCATAGCCCTACCTATCAGCACCGAAAAC
TCTTTTACACTAAGGGATTTTGCAAGAGCAGG
Sequence Type mRNA
Unitrap ID UNI26182

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 58389151..58394641 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075700 (2810407C02Rik) NM_001040396 RIKEN cDNA 2810407C02 gene Gene [Source:MGI Symbol;Acc:MGI:1916477]

 
Come back to gene ENSMUSG00000075700


For any suggestions or comments, please send an email to unitrap@crg.es