Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRS260
Clone ID RRS260
Vector pGT0Lxf
Project baygenomics

Sequence tag RRS260
Sequence
GTGACAGCTGCAACATGGCGGACGTGCTGAGCGTTGGTGTGAACCTGGAGGCCTTTTCGCAGGCTATTAGCGCCATCCAG
GCGCTACGCTCTAGCGTGAGTAGGGTCTTCGACTGCCTTAAGGATGGCATGCGCAACAAAGAGACGCTGGAGGGCCGCGA
GAAGGCCTTCATCGCGAACTTCCAGGACAACTTGCATTCCGTCAACCGGGACCTCAATGAACTGGAACGTTTGAGCAACC
TGGTAGGCAAGCCGTCTGAGAACCACCCTCTTCATAACAGTGGGCTGCTAAGCCTGGATCCTGTGCAGGACAAAACCCCA
CTCTACAGCCAGCTTCTGCAAGCATACAAATGGTCCAACAAG
Sequence Type mRNA
Unitrap ID UNI2526

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29202351..29205510 217
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026799 (Med27) NM_026896 mediator complex subunit 27 Gene [Source:MGI (curated);Acc:Med27-001]

 
Come back to gene ENSMUSG00000026799


For any suggestions or comments, please send an email to unitrap@crg.es