Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRS266
Clone ID RRS266
Vector pGT0Lxf
Project baygenomics

Sequence tag RRS266
Sequence
GCCAGAACAGAGAACCCTGTTATCATGGGTCTGTCCAGTCAGAACGGCCAGCTGAGGGGCCCTGTGAAAGCCAGTGCTGG
CCCTGGAGGAGGGGGCACACAGCCACAGCCACAGATGAACCAGTTGAAGAACAGCACAATCAATAATGGCACTCCACAGC
AAGCCCAGAGCATGGCCGCCACTATTAAACCTGGTGATGACTGGAAAAAGACATTAAAACTCCCTCCAAAGGATCTAAGA
ATCAAAACTTCGGATGTGACCTCCACAAAAGGAAATGAGTTTGAAGATTACTGTTTGAAACGAGAGTTGCTAATGGGAAT
TTTTGAAATGGGCTGGGAAAAACCATCTCCTAT
Sequence Type mRNA
Unitrap ID UNI4962

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44415485..44422395 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032097 (Ddx6) NM_007841 DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 Gene [Source:MGI Symbol;Acc:MGI:104976]

 
Come back to gene ENSMUSG00000032097


For any suggestions or comments, please send an email to unitrap@crg.es