Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST123999
Clone ID OST123999
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST123999
Sequence
GAACTGAGGCTGGAGGCTCGCAGGTCATCTTTACCAACCCTCTGGAGATAGTGAAGATCCGCCTGCAGGTAGCCGGAGAG
ATCACCACAGGACCGAGAGTCAGCGCTCTGAATGTGCTTCAGGACCTGGGACTTTTCGGGCTGTACAAGGGTGCCAAAGC
CTGTTTCCTCCGAGACATTCCCTTCTCCGCAATCTATTTTCCCGTGTACGCTCACTGCAAACTCCTCCTGGCTGATGAGA
ACGGACGCGTGGGAGGCATCAATCTCCTGACAGCGGGAGCCTTGGCAGGCGTACCTGCTGCTTCTNTGGNGACCCNTGCT
GATGTCATCAAGACAAGACTGCAAGTGGCCGCCAGAGCCGGCCAGACAACATACAGCGGGGTCGTCGACTGTTTCCGAAA
GATTCTCCGGGAAGAAGGGCCCTCGGCATTTTGGAAAGGGACTGCAGCTCGGGTGTTTCGATCCTCACCTCAGTTTGGTG
NCACTCTGGTTACCTACGAGCTTCTGNAGCGGNGGTTTTACATAGATTTTGGAGGCCTCAAACC
Sequence Type mRNA
Unitrap ID UNI26348

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71114489..71120669 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027010 (Slc25a12) NM_172436 solute carrier family 25 (mitochondrial carrier, Aralar), member 12 Gene [Source:MGI (curated);Acc:Slc25a12-001]

 
Come back to gene ENSMUSG00000027010


For any suggestions or comments, please send an email to unitrap@crg.es