Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST123562
Clone ID OST123562
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST123562
Sequence
GAACTGAGGTGACTCCTGCTCAGGTCATGCCGTTATCTGCTGATCCAGCCGGCCCTGCCAGGTGACCATGTCTGTCCTCG
GCCCAGTTCTTCTCCAGGTGTTCTGGGCCGGGTGTGTCGTCACCCTGCGGTCCCCTCTGCCAGCTGCTTTCACTGCCAAT
GGCACACATCTACAACACTTGGCAAGGGACCCCACCACAGGTACCCTCTATGTAGGGGCCACCAACTTCCTGTTCCAGTT
GAGCCCTGGGCTGCAGCTGGAAGCCGTGGTGTCCACGGGCCCTGTGAATGACAGCCGGGATTGCCTGCCACCTGTGATAC
CTGATGAATGTCCCCAAGCCCAGCCTACTAACAACCCTAACCAGCTGCTCCTGGTGAGCCCAGAGGCTCTGGTGGTGTGT
GGGAGCATACACCAGGGCATCTG
Sequence Type mRNA
Unitrap ID UNI26356

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 109001783..109002947 367
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053646 (Plxnb1) NM_172775 plexin B1 Gene [Source:MGI (curated);Acc:Plxnb1-001]

 
Come back to gene ENSMUSG00000053646


For any suggestions or comments, please send an email to unitrap@crg.es