Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRS314
Clone ID RRS314
Vector pGT0Lxf
Project baygenomics

Sequence tag RRS314
Sequence
AAGTTTCACAGAGCTTCGAAAGCCAACAAGAAGCCAGTTCAGTTACCTCGGGGAATGGTGAAGTCATTGTTGTACCATAT
CCTAGATGGGATTCACTATCTTCATGCCACACTGGGTGTTGCACAGGGATTT
Sequence Type mRNA
Unitrap ID UNI7720

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 147083180..147083310 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029635 (Cdk8) NM_153599 cyclin-dependent kinase 8 Gene [Source:MGI (curated);Acc:Cdk8]

 
Come back to gene ENSMUSG00000029635


For any suggestions or comments, please send an email to unitrap@crg.es