Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRN056
Clone ID RRN056
Vector pGT0Lxf
Project baygenomics

Sequence tag RRN056
Sequence
TAGGGGAAGCAATGGCCGCTGACGAAGATGAGTTGAACCTTCTGGTGATCATAGTTGACACCAACCCGATTTGGTGGGGA
AAGCAAGCATTAAAGGAATCTCAGTTTACTTTATCCAAATGCATGGATGCAGTGATGGTGCTGGCGAATTCTCACCTGTT
CATGAACCGCTCCAACCAGCTGGCTGTCATCGCCAGTCACATTCAGGAAAGCCGGCTCTTATACCCGGGGAAGAACGGTG
GACTTGGAGACTTCTTCGGAGACCCTGGCAATGCGCTCCCCGACTGTAACCCCTCTGGGAGTAAAGATGGGAAATACGAG
CTGTTGACAGCCGCAAACGAGGTGATCGCTGAGGAGATCAAGGATCTGATGACCAAGAGTGACATCAAGGGCCAGCATAC
GGAGACACTACTGGCAGGATCCCTGGCCAAAGCTCTGTGCTACATTCACAGAGTGAACAAGGCAGTTAAAGATAATCAGG
AGATGAAATCAAGGATTTTGGTGATCAAGGCTGCAGAGGACAGCGCACTGCAGTACATGAACTTCATGAACGTCATCTTT
GCTGCTCAGAAGCAGAATATCCTCATCGACGCCTGCGTGCTGGACTCGGATTCAGGGCTCCTCCAGCAGGCTTGTGACAT
CACTGGGGGACTGTACCTGAAGGTGCCTCAGATGCCTTCTCTCCTGCAGTACTTACT
Sequence Type mRNA
Unitrap ID UNI7728

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 125029190..125044839 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029387 (Gtf2h3) NM_181410 general transcription factor IIH, polypeptide 3 Gene [Source:MGI (curated);Acc:Gtf2h3-001]

 
Come back to gene ENSMUSG00000029387


For any suggestions or comments, please send an email to unitrap@crg.es