Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST122984
Clone ID OST122984
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST122984
Sequence
GAACTGAGGCGTGCTGGTCCCATGACAACAGAAGACAGGTCACCTCAGAAGATTGCCAAGAAGTTCAAGAGTGCCATATG
CCGNGTCACCCTGCTCGATGCTTCTGAGTATGAGTGTGAAGTGGAGAAGCACGGCCGGGGCCAGGTGCTGTTTGACCTGG
TCTGTGAACACCTTAACCTCCTGAAGGCATCAACATTTCTGGAAACTTCTACAGAAACAAGTTAAAGTATCTGGGCCTTT
CTCCGGAAGCGGATGAATACCAACCCCTCCCGAGGCCCCTACCACTTCCGAGCCCCCAGCCGCATTTTCTGGCGCACTGT
GCGAGAAAAAGCGGATGGNGGTCCCTGCTGCTCTCAAGGTTGTTCGGCTGAAGCCTACCAGAAAGTTTGCTTACCTGGGG
CGTCTGGCGCATGAAGTCGGGTGGGAAGTACCAGGCAGNGACAGCCACTCTGGAGGAGAAACGGAAGGAAAAGGCCA
Sequence Type mRNA
Unitrap ID UNI1712

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52381517..52382619 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003426 (Rpl13a) NM_009438 ribosomal protein L13a Gene [Source:MGI (curated);Acc:Rpl13a-001]

 
Come back to gene ENSMUSG00000003426


For any suggestions or comments, please send an email to unitrap@crg.es