Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRN046
Clone ID RRN046
Vector pGT0Lxf
Project baygenomics

Sequence tag RRN046
Sequence
GGGAGGAGGAGCAGGAAGAAGCTGAGGAGGAGGGCCAGGAAGGCCAAGGTGGGGTGGGCAGCCCCCTCAAGGGCGTGTCC
AAGAAGGGTAAGATGAGTTTGAAGCAGAAGATCAAGAAGGAGCCAGAGGAAGCTGGCCGAGAGGCACCCTCCATCACTCT
CCCCATGGTCACTGTCCCACAGATACCCTCTTACAGGTTGAACAAGATCTGTAGTGGTCTCTCCTTTCAGAGGAAGACCC
AGTTCATGCAGCGGCTTCACAACTACTGGCTGCTGAAGCGGCAGGCTCGGAACGGTGTCCCCCTCATCAGGCGCCTGCAC
TCCCACTTACAGTCCCAGAGAAATGCTGAG
Sequence Type mRNA
Unitrap ID UNI7731

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 28944149..28947611 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063952 (Brpf3) NM_001081315 bromodomain and PHD finger containing, 3 Gene [Source:MGI (curated);Acc:Brpf3-001]

 
Come back to gene ENSMUSG00000063952


For any suggestions or comments, please send an email to unitrap@crg.es