Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST122778
Clone ID OST122778
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST122778
Sequence
GAACTGAGGTTCGTCTTGGCACCAGAACAAGGCACTGCAACATCAGGCCTTTGCCCTAAACAGCTCACGATGCCAGGAAC
TGGCCAATTACTACTTTGGCTTCAGTGGATGGTCGAAAAGGATCATCAAG
Sequence Type mRNA
Unitrap ID UNI18922

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 101491550..101491674 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010362 (Rdm1) NM_025654 RAD52 motif 1 Gene [Source:MGI (curated);Acc:Rdm1-001]

 
Come back to gene ENSMUSG00000010362


For any suggestions or comments, please send an email to unitrap@crg.es