Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST122669
Clone ID OST122669
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST122669
Sequence
GAACTGAGGTCGTCTGTATNACAACATAAACTTCCAGCGAAAATCAGTTGTGGGATTTGTGGAGCTGACTATATTTCCCA
CAGTTGCCAACTTGAATAGAATTAAGTTGAACAGTAAACAGTGTAGAATATACCGAGTCCGGATCAATGACTTGGAGGCC
CGCTTTTATTTATAATGATCCAACCTTAGAAGTTTGTCACAGTGAATCGAAACAGTAAGTTGGGCACGTTAAGAAGCTGC
TGTTTGTACGTCATCCTGTCACTGTTTTCAGAGATTGTTTTTCAACAAACTTTCCCATTCTTATTGTAATAAAGCTATGT
GTTGTATAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI26374

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 54897300..54902994 274
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037343 (Taf2) NM_001081288 TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor Gene [Source:MGI Symbol;Acc:MGI:2443028]

 
Come back to gene ENSMUSG00000037343


For any suggestions or comments, please send an email to unitrap@crg.es