Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRN072
Clone ID RRN072
Vector pGT0Lxf
Project baygenomics

Sequence tag RRN072
Sequence
TCTTGTGAAGAGCCTTTGGGAGTTCTGGTAAACCCTAACATGTACCAGGCCCCTCCTCAGTGGGTTGACAACACCGGCTC
AACCCCACAGAAGAAGACTTCCCTCTCGGCAGGACCAAGACTAGAGCCCAGTTTACATCAGCACCAGCTGCGAATCCAGG
ACCAAGAATTCCAGGAAGGCTTCGATGGCGGCTGGTCCCTGTCTATGCATCACCCCTGGGCTTCTCTGCTTGTCAGGGGG
ATTAAAAGGGTGGAGGGCAGATCCTGGTATACTCCTCACAGAGGAAGACTTTGGATAGCAGCCACGGGCAAAAGACCTTC
CCCTCAGGAAGTCTCAGAACTCCAGGCTACCTATCGTCTTCTTCGTGGGAAAGATGTGGAGTTTCCAAATGACTATCCGT
CGGGTTGTCTTCTGGGCTGTGTGGACCTTATTGATTGCTTGTCCCAGAAACAATTTCAGGAG
Sequence Type mRNA
Unitrap ID UNI7175

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65699177..65706112 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032386 (Trip4) NM_019797 thyroid hormone receptor interactor 4 Gene [Source:MGI (curated);Acc:Trip4-001]

 
Come back to gene ENSMUSG00000032386


For any suggestions or comments, please send an email to unitrap@crg.es