Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST122536
Clone ID OST122536
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST122536
Sequence
GGATTGCCACGCATTTGAATTCATGCAGCGCGCCCTTCAGGACCTACGGAAAACCGCCTACAGCCTGGGACGCACGGACG
GAGACCCTCCTGCTGCAGGCTGAGCGCCGGGCTCTGTGTGCCTGCTGGCCAGCTGGACGCTGAAGATCTTTGGCCAGTGA
TATTCCTTGTCAATAAATGCCTGCTAGCAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI26025

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34326714..34327658 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070858 (Gm1673) NM_001033458 gene model 1673, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2686519]

 
Come back to gene ENSMUSG00000070858


For any suggestions or comments, please send an email to unitrap@crg.es