Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRN086
Clone ID RRN086
Vector pGT0Lxf
Project baygenomics

Sequence tag RRN086
Sequence
GGAGGAGGAGGAGGAAGCGACTGCCTCTGGATCTGCGGTGCGCGCCGGGCCGCCCAACAAGATAGCTGTGTTCCAGTTTT
GTTCAAAACTACTAGTGAAGAAGTCCTCCTCTCCTCTCATTCCCATATCTGCTTTCCGTCTGGACACAACATTGGGTCTA
AGAAAATCAG
Sequence Type mRNA
Unitrap ID UNI5569

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32390029..32421060 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024002 (Brd4) NM_198094 bromodomain containing 4 Gene [Source:MGI (curated);Acc:Brd4-003]

 
Come back to gene ENSMUSG00000024002


For any suggestions or comments, please send an email to unitrap@crg.es