Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST122499
Clone ID OST122499
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST122499
Sequence
CAATACCTGCAAATGGCCAGCAGGCCAGCAGCCAGAGTAAGTAGCTGCTGGGTGATGGGAGGATGCAAACAGGTTCCCCT
GGGAATGATTTTATAGTTTTTAGGCAAATCTCTTAGGATTATAAGTGAACAGGCCTTTGGTAGCATACTTTTGTTTTTAC
TTTTTTTTTCCGAGAGAGCGTCAAGACAGGGTCTCTGTGTATCCCTAACTATCATAGAACTCACTCTGTAGGCAGGTTCC
TTAGAATTCCACCAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI6843

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 98632681..98632934 254
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031311 (Nono) NM_023144 non-POU-domain-containing, octamer binding protein Gene [Source:MGI (curated);Acc:Nono-001]

 
Come back to gene ENSMUSG00000031311


For any suggestions or comments, please send an email to unitrap@crg.es