Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST122297
Clone ID OST122297
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST122297
Sequence
ATTTGCAACAGCATGAATCAAGAAAAGTTAGCCAAACTTCAAGCTCAGGTCCGGATAGGGGGCAAGGGTACAGCTCGCAG
GAAGAAGAAGGNGGTACATAGGACAGCTACTGNTGGTGACAAAAAGCTTCAGAGNTCACTAAAGAAACTGGCTGNGAACA
ATATAGCTGGTANTNGANGAGGTGAATATGATTAAAGACGATGGCACGGTTATTCATTTCAACAATCCCAAAGNCCAAGC
TTCCCTCTCCGCTAACACCTTTGCAATTACTGGTCATGCAGAAGCCAAACCAATCACAGAAATGCTTCCTGGGATATTAA
G
Sequence Type mRNA
Unitrap ID UNI24237

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 108491803..108503188 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028568 (Btf3l4) NM_027453 basic transcription factor 3-like 4 Gene [Source:MGI (curated);Acc:Btf3l4-001]

 
Come back to gene ENSMUSG00000028568


For any suggestions or comments, please send an email to unitrap@crg.es