Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRN121
Clone ID RRN121
Vector pGT0Lxf
Project baygenomics

Sequence tag RRN121
Sequence
AACCTATCAGACATTGGCTGGCCAGTGTTTGAAATCCCCTCCCCTCGGCCGTCCAAGGGCTACGAGCCAGAGGACGAGGT
CGAGGACACGGAGGTTGAGCTGAGGGAGCTGGAGAGCGGGACGGAGGAGAGTGACGAGGAGCCAACCCCCAGTCCGAGGG
TGCCAGAGCTCAGGCTGTCCACAGACGCCATCTTGGACAGTCGCTCCCAGGGCTGCGTCTCCAGGAAGCTGGAGAGGCTC
GAGTCAGAGGAAGATTCCATAGGCTGGGGGACAGCGGACTGTGGCCCTGAAGCCAGCAGGCATTGTTTGACTTCTATCTA
TAGACCATTCGTGGACAAAGCACTGAAGCAAATGGGGCTAAGAAAGTTAATTTTACGACTTCATAAGCTTATGAATGGGT
CCTTGCAAAGAGCTCGTGTAGCTCTGGTGAAGGACGACCGTCCAGTGG
Sequence Type mRNA
Unitrap ID UNI7595

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 12463731..12464178 448
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014426 (Map3k4) NM_011948 mitogen-activated protein kinase kinase kinase 4 Gene [Source:MGI Symbol;Acc:MGI:1346875]

 
Come back to gene ENSMUSG00000014426


For any suggestions or comments, please send an email to unitrap@crg.es