Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CH0294
Clone ID CH0294
Vector pGT0lxr
Project sanger

Sequence tag CH0294
Sequence
CAATCGCGGACCGGGCGGTGGACGCGGAGCGGCGGGGCCCTGACCCTCCCAACGGTGTCGCAGACCGGAGTGGCTGTGCC
TCGTCCGCACTTGCCAGGGCGGCCCTCATGGCGCTGCTCCGACGCCCGACGGTGTCCAGTGATTTGAAGAATATTGACAC
AGAAGTTATTCCTAAAGCCAAGAGCCATGTGACTATCCGGCGGGCAGTTTTAGAAGAAATTGGAAATAAAGTTAGAAACA
GAACCACTCAGGTGGCGAAGAAACCTCAGAACACCAAAGTACCAGCTCTGCCCACCAAAGTGACAAATGTCAACAAGCAG
CCGAAACCCACAGCCTCTGTAAACCAGTGCAGATGGAGGCGCTAGCTCCCAAG
Sequence Type mRNA
Unitrap ID UNI795

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70266601..70269353 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032218 (Ccnb2) NM_007630 cyclin B2 Gene [Source:MGI Symbol;Acc:MGI:88311]

 
Come back to gene ENSMUSG00000032218


For any suggestions or comments, please send an email to unitrap@crg.es