Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRN178
Clone ID RRN178
Vector pGT0Lxf
Project baygenomics

Sequence tag RRN178
Sequence
CCTTAAACAAAGAGAAGCAATTCTGCAAGTGATTACTTCAAAGATGCCCATCTCCAGTCATATTGATTTAGGTCTCCTGG
CAGAAATGACGGTTGGCTATGTTGGTGCTGACCTGACAGCACTCTGTAGGGAGGCTGCCATGTGTGCCCTTCTCAAGAAT
GAGAAGAACCAAGACAGTCCTAAAATGGAGGAAACAGATTTTCTGGAAGCTTTTAAAAAGATTCAGCCCTCATCATTTGG
AAGTTCCACTGGACTGATGGACATCAAGCC
Sequence Type mRNA
Unitrap ID UNI2355

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 122458275..122458440 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074876 (Spata5l1) spermatogenesis associated 5-like 1 Gene [Source:MGI Symbol;Acc:MGI:3036261]

 
Come back to gene ENSMUSG00000074876


For any suggestions or comments, please send an email to unitrap@crg.es