Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRN188
Clone ID RRN188
Vector pGT0Lxf
Project baygenomics

Sequence tag RRN188
Sequence
TTTTTCTTTTTTGTTCCTAGGCCAGTTCCCCAGTTCCAGTCGCCGTCGCCTGCACAGTGGCAGCCGCCGCCTCCCACCAG
CTCGCCCAAGGAAAAGGGAACGCGCGCGAATACGGGGGTCCCCGCCCCAGTCTTTCCCCGGAACCATGAACCCTAACTGT
GCCCGGTGCGGCAAGATCGTGTACCCCACGGAGAAGGTGAACTGTCTGGATAAGTACTGGCATAAAGCATGCTTTCACTG
CGAGACCTGCAAGATGACCCTGAACAGGAAGAACTACAAGGGTTATGAGAAGAAGCCTTACTGCAATGCACACTATCCCA
AGCAGTCCTTCACCA
Sequence Type mRNA
Unitrap ID UNI7765

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97660981..97677037 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038366 (Lasp1) NM_010688 LIM and SH3 protein 1 Gene [Source:MGI (curated);Acc:Lasp1-001]

 
Come back to gene ENSMUSG00000038366


For any suggestions or comments, please send an email to unitrap@crg.es