Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRN197
Clone ID RRN197
Vector pGT0Lxf
Project baygenomics

Sequence tag RRN197
Sequence
CGGGGGCTGGTGCGGGGCCGCTGGTGCCGGGTGGCAGCTGCAGAGCTGGAGGCGGTGGCCACTGTGCCTGGAAGCTAGCT
GTGCTGCAGGAGCTGCGGCTGCTGCTGCCACTGCATAGAAGTAACCTCTTGGGCCAGCCCTTCCTCACTCTCTGGAGATG
GCAGGCGAGATCACAGAGACCGGAGAGCTCTATTCTCCTTAT
Sequence Type mRNA
Unitrap ID UNI3039

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 115048824..115049636 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045980 (Tmem104) NM_001033393 transmembrane protein 104 Gene [Source:MGI (curated);Acc:Tmem104-001]

 
Come back to gene ENSMUSG00000045980


For any suggestions or comments, please send an email to unitrap@crg.es