Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST121808
Clone ID OST121808
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST121808
Sequence
TAAGCAATGGCATCAACCATTCCCCTCCTACCCTGAATGGTGCCCCATCGCCAACCACATTGCC
Sequence Type mRNA
Unitrap ID UNI21125

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154330289..154330346 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038533 (Cbfa2t2) NM_172860 core-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human) Gene [Source:MGI (curated);Acc:Cbfa2t2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 60622899..60622956 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070791 (AC140317.2)  

 
Come back to gene ENSMUSG00000070791


For any suggestions or comments, please send an email to unitrap@crg.es