Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRM201
Clone ID RRM201
Vector pGT0Lxf
Project baygenomics

Sequence tag RRM201
Sequence
ACAGGAGCCCCGGAGCCACAGCCGCAGCCGCCGTCCGCGGAGCCCAGCCCAACCGGCCATGGCGCTGTCGATGCCCCTGA
ACGGGCTGAAGGAGGAGGACAAAGAGCCCCTCATCGAGCTCTTCGTCA
Sequence Type mRNA
Unitrap ID UNI7776

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 134828435..134828562 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037242 (Clic4) NM_013885 chloride intracellular channel 4 (mitochondrial) Gene [Source:MGI (curated);Acc:Clic4-001]

 
Come back to gene ENSMUSG00000037242


For any suggestions or comments, please send an email to unitrap@crg.es