Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST121592
Clone ID OST121592
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST121592
Sequence
TGCCCCCCCAGGAGACAAAGAGCCTCATGAAGGCTTCCTACACGCCCGAGGTGATAGAGAAGTCGGTGAGGGATGTGGAA
CACTGGCACGGGAGGAAGACGGATGACCTAGGCCGGTGGCACCGGAAGAATGCTATGAACATGAACTTGCAGAAAGCGCT
GGAAGAGAAATACGGAGAGAAGAGCAGATCCAAGGCCAAGTAGTTGAAAGGACATTGGGAGGAAGCTTGAGAATGTTGCC
AATAAAGAAATAAAGGCTGTGGTCTGCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI26387

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 78208835..78209282 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062154 (1700061J05Rik) RIKEN cDNA 1700061J05 gene Gene [Source:MGI Symbol;Acc:MGI:1920626]

 
Come back to gene ENSMUSG00000062154


For any suggestions or comments, please send an email to unitrap@crg.es