Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRM217
Clone ID RRM217
Vector pGT0Lxf
Project baygenomics

Sequence tag RRM217
Sequence
AACTGAAGCAGATAAAGCAAAAGGAGAAAAAGAATAATGCTGACACTTTATATGAAGTTGTGTGTTTGGAGAGTGAGTCA
GAGAGAGAGAGGAGGAAAACCACAGCCAGTCCTTCAGTTCGCCTGCCACAGTCTGGATCCCAGAGCTCCATGATCCCCTC
TCCCCCAGAAGATGATGAAGAAGAAGATAATGATGAACCTCTCTTGAGTGGATTTGGGGATGTATCCAAAGAATGTGCAG
AAAAAATTCTTGAAACATGGGGAGAACTGCTGTCAAAATGGCATCTCAACTTGAGTGTGAGACCGAAGCAGTTGTCATCC
TTAGTGAGAAGTGGTGTTCCTGAAGCTCTTCGTGGAGAAGTCTGGCAGCTGCTAGCAGGCTGCCACAACAACGATCACTT
AGTAGAAAAGTACCGAATTCTCATCACAA
Sequence Type mRNA
Unitrap ID UNI3897

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 37351101..37364596 179
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035437 (Rabgap1) NM_001033960 RAB GTPase activating protein 1 Gene [Source:MGI (curated);Acc:Rabgap1-004]

 
Come back to gene ENSMUSG00000035437


For any suggestions or comments, please send an email to unitrap@crg.es