Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRM224
Clone ID RRM224
Vector pGT0Lxf
Project baygenomics

Sequence tag RRM224
Sequence
GGTTGTGAGCTTTTTTAGATGGTTTTTTTTTTTTTTTTTAGACAACACCACCTCATGTTATCGGTCAGTTGGACAAACTG
ATTAGAGAGGTGTCTACCTTGGATGGGGTGCTAGAAGTCCGAAATGAACACTTTTGGACCCTTGGATTTGGCTCATT
Sequence Type mRNA
Unitrap ID UNI4277

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 74817941..74818939 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024069 (Slc30a6) NM_144798 solute carrier family 30 (zinc transporter), member 6 Gene [Source:MGI Symbol;Acc:MGI:2386741]

 
Come back to gene ENSMUSG00000024069


For any suggestions or comments, please send an email to unitrap@crg.es