Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0024
Clone ID GC0024
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0024
Sequence
CTTGAAACTCTGTGTTGTCGAGGCCCCTGATGGCCTCCACCGCATCCTCTGCCCGCTCCATGTGTACAAAGGCATAATCT
TTCACGATGTCACATTCGATGACTGGGCCGTACTCCTCAAACTTGGCCCGAAGCTCTTGGTTGGTACAAGTGGGGCTGAT
GTTGCCCACGTGTAACTTGGTTGAAGCTTTGCTCTTATTCTTGCTGGCTTCCACATTGATGTTCACTCCGTGCAGCTTGT
AGTGGTGCAGGTTGCGTATGGCATCCTCAGCGGCCGTCTTGTCCTCTATGTGCACAAAGCCATAATTCTTAATGATGTCA
CATTCCAGCACCTTCCCGTACTGCTCGAAGAGTGAGCGGATCTCCTGCTCTGTGGCCTCCGGGCAGATTCCATGAACAGC
TTACCATCTCACACAGCCGCACTAAGTCAGGACGATGTCGGTCTAAGGACGGGGCCAGACGAACCCACTTGCACCTG
Sequence Type mRNA
Unitrap ID UNI100

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4792398..4792821 400
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056951 (Rbm4) NM_009032 RNA binding motif protein 4 Gene [Source:MGI Symbol;Acc:MGI:1100865]

 
Come back to gene ENSMUSG00000056951


For any suggestions or comments, please send an email to unitrap@crg.es