Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST121430
Clone ID OST121430
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST121430
Sequence
ATTACCACCATGGCGCAAAAATACCANTCCCCAGNGCGGGTGTATAAACATCCCTTTGAGTTAATTATGGCTGCCTATGA
GAGGAGGNTTNCTACNTGNACTCTGATTCCANTGTTCGAAGAGCAGANACACTGCCGAGCGAGANCAAGAGTGAGGATGG
GGCTCTTNATGTCATCGAGAGGCGCTGCANGNTGGATATAGANGCGCCCAGGCTGTTGAAGAAGATCGCAGGAGTCGATT
ACGTTTATTTTGTCCAGAAAAACTCCCTGAATTCTCGAGATCGCACTTTGCACATCGAGGCCCACAATGAGACATTTTCT
AACCCGGGTCATCATCCACGAACACTGCTGTTACACGGTTCACCCTGAGAATGAAGACTGGACCTGTTTCGAACAGTCTG
CAAGTTTAGATATCAAATCCTTCTTTGGTTTGAAAGNCAGNGGAAAAAATTGCCATGAAACATTATCC
Sequence Type mRNA
Unitrap ID UNI26391

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 116978495..117004711 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020823 (Sec14l1) NM_028777 SEC14-like 1 (S. cerevisiae) Gene [Source:MGI (curated);Acc:Sec14l1-007]

 
Come back to gene ENSMUSG00000020823


For any suggestions or comments, please send an email to unitrap@crg.es