Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST121335
Clone ID OST121335
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST121335
Sequence
GTAGTGAAGCCACACGCTCCATTAATAAAGTTCCCTAACAGAAGAGACAAACCTAAACTCAGTG
Sequence Type mRNA
Unitrap ID UNI7918

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101511123..101511186 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061474 (Mrps36) NM_025369 mitochondrial ribosomal protein S36 Gene [Source:MGI (curated);Acc:Mrps36-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 135739690..135739753 64
NO GENE  

 
Come back to gene ENSMUSG00000061474


For any suggestions or comments, please send an email to unitrap@crg.es