Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRM278
Clone ID RRM278
Vector pGT0Lxf
Project baygenomics

Sequence tag RRM278
Sequence
GTTGCAAATGTTGCTCAGAAGTTCTGCAAGCAAGCCATCATTCTTAAGCAAGTGGCACATTTTTACAATTCCATTGATCA
ACAGATGATTCAGAGTCAGAGGCCAATGATGCTGCAGTCTGCCTTAGCATTTGAACAGATAATTAAAAATTCAAAAGCAG
GGAGTGGAGGCAAGTCACAGATTACTTGGGACAACCCTAAAGAACTAGAAGGCTACATCCAGAAACTACAAAATGCTGCT
GAGCGACTTGCCACAGAGAATAGAAGACTGAGAAAGTGGCACACTACATTTTGTGAAAAGGTTGTCATTCTTATGAATAT
TGATCTGCTTCGGCAGCAGCAGCGTTGGAAGGATGGACTGCAGGAACTGAGAACTGGCTTAGCGACTGTGGCAGCG
Sequence Type mRNA
Unitrap ID UNI7791

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7158832..7162781 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047193 (Dync2h1) NM_029851 dynein cytoplasmic 2 heavy chain 1 Gene [Source:MGI Symbol;Acc:MGI:107736]

 
Come back to gene ENSMUSG00000047193


For any suggestions or comments, please send an email to unitrap@crg.es