Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRN240
Clone ID RRN240
Vector pGT0Lxf
Project baygenomics

Sequence tag RRN240
Sequence
ACAGAGAGAGTACAAGGCGGGTGCTTTCGATGCCAAGCGGGCTGGAGATCTAGTCCGTGCTCGGGAGCTCATGAGGATCG
CGAAGAGATTTGGTACTGTCCTAGAGGCCCTGGAAAAGGGTCAGCCTGTGGACCTGAGTGGCATGCCCCCAGCACTTGCG
GATCTGAAGGCCCTCCCCCAGGCTTCTAAGGCCTCCTCAGCAACCCAAGGCCTGTCCCCAGCAGTAGAGCAAATGCAGCC
AGTGATGGCCTCTGACCTCCCAGCCACCCCAGTGGCCCCTGCGGAGCCAACAACAGTGCTGGATGCTTTACAGCAAAGGC
TGAACAAGTATCGTGAGGCAGGCATCCAGGCCCGGGCCAATGGGGATGAGCGCAAGGCCAGGATGCACGATCGCATTGCC
AAGCAATATCAGGATGCTGTTCGAGCTCATCAGGCAGGACAGAAAGTTGACTTTGCCGAGTTACCTGTTCCT
Sequence Type mRNA
Unitrap ID UNI7795

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 108298674..108299721 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028582 (Cc2d1b) NM_177045 coiled-coil and C2 domain containing 1B Gene [Source:MGI (curated);Acc:Cc2d1b-001]

 
Come back to gene ENSMUSG00000028582


For any suggestions or comments, please send an email to unitrap@crg.es