Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRN270
Clone ID RRN270
Vector pGT0Lxf
Project baygenomics

Sequence tag RRN270
Sequence
AGGGTCACAGGAATCAAAGTCGGCGAGAAGGAATATCTTTGCAGCAAGACCCAGGGGCGTTGTATGACTTTAATTTTGAT
GAGGAATTGGAAATTGATCTTGATGATGAACCAATGGAAGCTATGTTTGGACAAGTCCTGACCAGTGACATATGATATTC
TGGGAATGTGGATCCCAG
Sequence Type mRNA
Unitrap ID UNI7800

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 66309528..66309704 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038664 (Herc1) hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1 Gene [Source:MGI (curated);Acc:Herc1-001]

 
Come back to gene ENSMUSG00000038664


For any suggestions or comments, please send an email to unitrap@crg.es