Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRN286
Clone ID RRN286
Vector pGT0Lxf
Project baygenomics

Sequence tag RRN286
Sequence
TTGTGTTTTTAATTTAAAGAGCCAGAGAAGCCCAAAGTCCGGAGCAGTTGGCCTGAGGAGCTGGAAGACTGCTGCCCTAC
GCGGGGCCTACCCCTTGAGCCCTTGCTCGCCGACGGCGAGCTGCTGCAGGCATGTCCCGGGCCACCCTCGGACCCAGGAC
CAGCGTTGTCGCTGCCCAGCGAGCCCGGGACAGCTCAGGAGGAGGGTGCACGCCTCAGGGCGGTATTTGACGCCCTGGAC
AGAGATGGGGACGGCTTCGTCCGCATCGAGGATTTCATCCAATTCGCCACGGTCTATGGGGCAGAG
Sequence Type mRNA
Unitrap ID UNI7802

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26204530..26204833 300
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037098 (Rab11fip3) RAB11 family interacting protein 3 (class II) Gene [Source:MGI (curated);Acc:Rab11fip3-001]

 
Come back to gene ENSMUSG00000037098


For any suggestions or comments, please send an email to unitrap@crg.es