Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRN303
Clone ID RRN303
Vector pGT0Lxf
Project baygenomics

Sequence tag RRN303
Sequence
GTGAAGCACAGGACCTCCTGTCCCAGATTGCCCAGCTGCAGGAGGAGAATAAGCAGCTGATGACCAACCTCAACCACAAG
GACGTGGGCTTCTCCGAGGAGGAGTTCCAGAAGCAGGAAGGCATGTCAGAGCGTGAACGGCAGGTGATGAAGAGGCTGAA
GGAGGTGGTGGACAAGCAGAGGGATGAGCTCCGAGCCAAAGACAGGGAGCTGGGCCTGAAGAATGAGGACGTCGAGGCTT
TGCAGCAGCAGCAGACGAGGCTAATGAAGATCAACCATGACCTTCGGCACCGGGTCACCGTGGTGGAGGCCCAGGGGAAA
GCCCTGATTGAGCAGAAGGTGGAGCTCGAAGCAGACCTGCAGACCAAGGAGCAGGAGATGGGCAGCCTGCGGGCTGAACT
AGGAAAGCTTCGCGAGAGGCTGCAGGGCGAGCACAGCCAGAATGGGGAGGAGGAGGAGGCTG
Sequence Type mRNA
Unitrap ID UNI7803

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 124964530..124971379 219
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029392 (Rilpl1) NM_021430 Rab interacting lysosomal protein-like 1 Gene [Source:MGI Symbol;Acc:MGI:1922945]

 
Come back to gene ENSMUSG00000029392


For any suggestions or comments, please send an email to unitrap@crg.es